HCR-seq

This repo contains code for processing and analyzing HCR-seq data

Installation

To install this package and its prerequisites

conda install -f environment.yaml
pip install -e .

HCR-seq Amplicon analysis

Preparing a reference

The latest version of the reference is here.

This reference was prepared with the following command:

hcrseq amplicon prepare-reference --reporter_info=reporter_info.txt \
                                  --mmej_variants=MMEJ_variants.txt \
                                  --forward_primer=ACAACCACTACCTGAG \
                                  --reverse_primer=TCACTTGTACAGCTCGTCCATGC \
                                  --outstem=amplicon/HCRseq_v0.1

The files used to build it are here. The two main inputs are reporter_info.txt which contains information about the sequence and lesion positions of each reporter, and MMEJ_variants.txt which gives expected MMEJ deletion variants to be added to the reference. Once run, the following files will be prepared.

Reference fasta

This is a fasta file containing the sequence of all amplicon sequences, including possible MMEJ variants. It will also have associated index files.

Primer file

This file specifies the primer sequences used. These are used to identify read pairs conforming to the expected amplicon structure and for adapter trimming.

Lesion info file

This file specifies site specific lesions that should be quantified.

Pathway calculation file

This file specifies how each repair pathway should be calculated.

Preprocessing

This step performs the following operations

• Creates a consensus between read 1 and read 2
• Extracts the UMI sequence and deduplicates
• Aligns amplicon sequences to reference

hcrseq amplicon preprocess --fq1=${fq1} \
      --fq2=${fq2} \
      --reference=${ref} \
      --primer_config=${primer_file} \
      --outstem=${outstem}

Quantification

Given an aligned bam, this step counts reporters and calculates pathway activities

hcrseq amplicon quantify --bam=${outstem}.bam \
                --lesion_info=${lesion_info} \
                --pathway_info=${pathway_info} \
                --outstem=${outstem}

Running in Terra

See the following workspace as an example of running preprocessing in Terra https://app.terra.bio/#workspaces/broad-getzlab-fmhcrsparc-terra/Nagel-FM-HCR-Amplicon-experiment7

Single-cell processing

Reference preparation

First prepare a cellranger-compatible reference including reporter plasmids as follows

hcrseq scrna prepare-reference --plasmid_fasta=[plasmid_fasta] \
                    --genome_fasta=[genome_fasta] \
                    --gtf=[gtf] \
                    --outstem=[outstem]

Alignment

The data can the be processed using cellranger count. Afterwards, data can be post-processed using hcrseq as follows.

hcrseq scrna quantify --h5_file=[h5_file] \
          --bam=[bam] \
          --lesion_info=[lesion_info] \
          --pathway_info=[pathway_info] \
          --outstem=[outstem]

This will produce a scanpy h5ad file with repair measurements annotated in adata.obs.