Skip to content

TobyBaril/SA-SSR

 
 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

36 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

README
======

Table of Contents
-----------------

  I. Introduction
 II. Installation Instructions
III. Usage Instructions and Examples
 IV. Funding and Acknowledgements
  V. Contact


I. Introduction
---------------
SA-SSR is a software tool developed to find Simple Sequence Repeats (SSRs) in
a sequence (presumably of DNA or RNA). SSRs are sometimes referred to as Short
Tandem Repeats (STRs) or microsatellites. SSRs are genetic markers with several
interesting and meaningful biological implications. For example, SSRs can play
significant roles in species identification and in genome alignment against a
reference and species identification.

Many software tools exist for this purpose, but vary widely in utility. Some
key features of our tool are as follows:

    - Fast run time (linear, O(n), time complexity)
    - Memory efficient (linear, O(n), space complexity)
    - Finds all perfect repeats
    - Simple command-line interface, convenient for scripting and when running
      on High-Performance Computing (HPC) systems (note: no GUI provided)
    - Easily parsed, tab-delimited output
    - Runs on Linux (not Windows or Mac OS X)

See our paper in Bioinformatics for further information:
    http://bioinformatics.oxfordjournals.org/content/early/2016/05/11/bioinformatics.btw298


II. Installation Instructions
-----------------------------
To compile SA-SSR, simply type `make'. The binary will be in the `bin'
directory. Your compiler must support C++11.

To compile and install, type `make' followed by `make install'.  The binary
will be in both the `bin' and `/usr/local/bin' directories (to change this,
change the `PREFIX' variable in `Makefile').  

To uninstall, type `make clean'.

See `INSTALL' for further instructions.


III. Usage Instructions and Examples
-------------------------------------
Please run the software with the `--help' option for complete usage instructions
(i.e., type `sa-ssr -h' or `sa-ssr --help'). The format of the input and
output files is described below; followed by usage examples.

Input File Format:

    Description:

        The input file must be in Fasta format. The sequences may be on a single
        line or multiple lines. The header and sequence lines must not contain
        any leading or trailing whitespace. The header line must not contain any
        tabs. The sequence lines must not contain whitespace between
        nucleotides. Mixed-case nucleotides are acceptable; they will be
        replaced with uppercase nucleotides for finding SSRs.

    Good Example:

        >sequence 1
        AGCGTGTCGTGTACACGTGTACGTACGTACGATCGATGCTACGTAGCATCGATCGACGTATCGTATCGATC
        CACGTGTACGTACGTACGATCGATGCTACGTAGCATCGATCGACGTATCGTATCGATCAGCGTGTCGTGTA
        .
        .
        .
        >sequence 2
        cgtacgatcgatgctacgtagcatcgatcgacgtatcgtatcgatcagcgtgtcgtgtacacgtgtacgta
        gatcgacgtatcgtatcgatcagcgtgtcgtgtacacgtgtacgtacgtacgatcgatgctacgtagcatc
        .
        .
        .
        >sequence 3
        taTCgATCAGCGtGTCGTGTAcACGTGTACGTAcgtaCGAtCgATGCTACGTagcatCGATCGACGTATCG
        cgtacgtacgATCGATGCTACGTaGCATCGaTCGaCGTAtCGTAtcgatcaGCGTGTCGTGTAcacgtgta
        .
        .
        .

Output File Format:

    Description:

        The output file is tab-delimited. Each row is a separate record. By
        default, if no SSRs are found in a fasta sequence, no output record
        will be present in the output file for that fasta sequence. When SSRs
        are found, one output record will be present in the output file for
        each SSR in that sequence. Each column contains a separate piece of
        information for the output record. The default columns (in order) are:

            Sequence_Name, SSR, Repeats, Position (zero-based)

        By using the correct command-line options, an additional column may be
        added between `Sequence_Name' and `SSR' containing the entire sequence
        associated with the `Sequence_Name'. The columns would then become:

            Sequence_Name, Sequence, SSR, Repeats, Position (zero-based)

        Each of the columns are described below:

        Sequence_Name: The entire header line from the fasta file (excluding the
                       leading `>' character) from which the SSR in the given
                       output record is found.

             Sequence: The entire sequence from the fasta file in which the
                       SSR in the given output record is found. The sequence
                       will be uppercase. If taken from a multi-line sequence
                       in the fasta file, it will be joined into one continuous
                       sequence. Note, this column will only be added if
                       requested by command-line option.

                  SSR: The repeating unit of an SSR. For example, `ACACAC' is
                       an SSR with a repeating unit of `AC'.

              Repeats: The number of times the repeating unit of an SSR repeats.
                       For example, the repeating unit of `AC' from SSR `ACACAC'
                       repeats 3 times.

             Position: The zero-based position in the original fasta sequence
                       where the SSR begins. For example, `ACACAC' begins at
                       position 2 in the sequence `TGACACACGT'.

        If desired, the output file may also contain an output record for the
        fasta sequences where no SSRs were found. Consult the command-line
        options to see how to do this.

        As a simple illustration of the output file, consider the following
        input file and its respective output file:

        Input:

            >seq 1
            TGACACACGT
            >seq 2
            acgtg
            tgtca
            cagtc

        Output (formatted here for readability):

            Sequence_Name   SSR   Repeats   Position (zero-based)
            seq 1           AC    3         2
            seq 2           GT    3         2
            seq 2           CA    2         8


Usage Examples:

    Basic Usage Examples:

        Example 1:
        
            sa-ssr input.fasta output.tsv

            Run SA-SSR on fasta sequences in `input.fasta' and write results to
            `output.tsv'. This will use the default parameters; run the software
            with `--help' to see the defaults and check if they meet your needs.
        
        Example 2:
            
            sa-ssr -l 50 -L 200 input.fasta output.tsv

            Run SA-SSR on fasta sequences in `input.fasta' that are between
            50 and 200 base pairs long; i.e., do not search for SSRs in fasta
            sequences shorter than 50 or longer than 200 bps. All results
            will be in `output.tsv'.
        
        Example 3:
            
            sa-ssr -m 2 -M 9 -r 3 -R 20 input.fasta output.tsv
            
            Run SA-SSR on fasta sequences in `input.fasta' and write results to
            `output.tsv'.  Only SSRs meeting the parameters provided will be
            included.  The meaning of each option is as follows:

                -m, -M    The min (-m) and max (-M) length of the repeating unit.
                          As examples: `AAAAAA...' and `ACGCAGTTGCACGCAGTTGC...'
                          would not make the cutoff because `A' is shorter than
                          2 nucleotides (-m 2) and `ACGCAGTTGC' is longer than 9
                          nucleotides (-M 9). However, `ACACAC...' and
                          `AATCCTGGTAATCCTGGT...' would be included.
                
                -r, -R    The min (-r) and max (-R) times the repeating unit
                          repeats.  As examples: `ACAC' and `ACACACACACACACACACACAC
                          ACACACACACACACACACAC' (21 `AC' units) would not make the
                          cutoff. However, `ACACAC' and `ACACACACACACACACACACACACAC
                          ACACACACACACAC' (20 `AC' units) would be included.
        
        Example 4:

            sa-ssr -t 4 input.fasta output.tsv

            Run SA-SSR on fasta sequences in `input.fasta' and write results to
            `output.tsv'.  Use 4 threads of execution, instead of the default 1.

        Example 5:

            sa-ssr -l 50 -L 200 -m 2 -M 9 -r 3 -R 20 -t 4 input.fasta output.tsv

            Run SA-SSR on fasta sequences in `input.fasta' and write results to
            `output.tsv'. This is a combination of examples 2, 3, and 4.


    Extended Example:

        The data for this extended example can be found in the `examples'
        directory. The input fasta file is `input.fasta'. The output files are
        `output_default.tsv' and `output.tsv'. The data and example are
        fictitious, but was modified from real sequences. The numbers used for
        min/max sequence length or any other parameter may not be biologically
        realistic; however, they do conceptually represent a realistic
        situation.

        input.fasta: Each fasta sequence is a contig generated from a de novo
                     assembly of whole exome sequencing reads. The file has 16
                     fasta sequences.

         output*.tsv: The output files from running SA-SSR as shown below.

        One could just run SA-SSR with the defaults:

            sa-ssr input.fasta output_default.tsv

        However, the defaults may not be the best parameters for your data.
        Below is a reasonable command to use with this example data. Each
        alteration from the default is explained and justified based on the
        data in this example.

            sa-ssr -l 70 -L 300 -m 2 -M 9 -r 2 -t 4 -f input.fasta output.tsv

        -l 70    Do not search for SSRs in fasta sequences less than 70 bps in
                 length. For sake of the example, we assume based on our reads
                 and the assembler's parameters and intricacies that the
                 resulting contigs should be equal to or longer than 70 bps.
                 Anything shorter would be erroneous and not worth searching for
                 SSRs.

        -L 300   Do not search for SSRs in fasta sequences more than 300 bps in
                 length. For sake of the example, we assume based on our reads
                 and the assembler's parameters and intricacies that the
                 resulting contigs should be equal to or shorter than 300 bps.
                 Anything longer would be erroneous and not worth searching for
                 SSRs.

        -m 2     Do not report SSRs where the base unit is less than 2 bps
                 in length. This decision must be made based on your research
                 question(s) and what you deem biologically interesting.

        -M 9     Do not report SSRs where the base unit is more than 9 bps
                 in length. This decision must be made based on your research
                 question(s) and what you deem biologically interesting.

        -r 2     Do not report SSRs where the base unit repeats less than 2
                 times. This decision must be made based on your research
                 question(s) and what you deem biologically interesting.

        -t 4     Use 4 threads of execution instead of the default 1. This must
                 be based on the machine you run SA-SSR on. Obviously, it
                 doesn't make sense to run with 9 threads on an 8 thread
                 machine.

        -f       Output the full sequence from the fasta file from which an SSR
                 in a particular output record was found. This may be desirable
                 if your downstream analysis requires knowing the full sequence
                 from which the SSR was found. This option is intended to ease
                 downstream analysis by removing the requirement to parse the
                 original fasta file and the output file simultaneously. If you
                 do not need this, do not use this option as it will radically
                 increase the size of the output file.

        If you inspect these two output files, you'll observe 12 output records
        in `output_default.tsv' and 7 output records in `output.tsv'. Using the
        custom parameters removed 6 output records; each were theoretically
        erroneous results (the SSRs really were there in the fasta sequence,
        but the fasta sequence wasn't valid). 1 additional output record was
        added by using the custom parameters because the fasta sequence was
        below the minimum length for processing under the default parameters.


IV. Funding and Acknowledgements
-------------------------------
Funding for the research and production of this software was provided by
startup funds to Dr. Perry Ridge.


V. Contact
-----------
For questions, comments, concerns, feature requests, suggestions, etc., please
contact:

Pery Ridge, Ph.D. -- perry.ridge@byu.edu

Note: For usage questions, please consult section `III. Usage Instructions and
Examples' first.

About

A Novel Algorithm for SSR Discovery in Genetic Sequences

Resources

Stars

Watchers

Forks

Releases

Packages

Contributors

Languages